|
|
||||||||
From the Department of Neurology of the Rudolf Magnus Institute for Neurosciences (Drs. Bosboom, Van den Berg, and Wokke, I. Mollee, L.D. Sasker, and J. Jansen); and the Department of Immunology (T. Logtenberg), University Medical Center Utrecht, the Netherlands.
Address correspondence and reprint requests to Dr. Leonard H. van den Berg, Department of Neurology, University Medical Center Utrecht, P.O. Box 85500, 3508 GA Utrecht, the Netherlands; e-mail: l.h.vandenberg{at}neuro.azu.nl
| Article Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Analysis of T-cell receptors (TCR) in affected tis-sue may show 1) a broad TCR repertoire without Vß family overrepresentation (similar to that found in peripheral blood or normal lymph nodes), indicating that the T cells have been attracted nonspecifically by a proinflammatory environment; 2) a restricted TCR repertoire with Vß family overrepresentation but without evidence of clonal expansion, indicating that there may be a superantigen-driven T cell expansion; or 3) a restricted TCR repertoire with Vß family overrepresentation and clonal expansion, indicating that the T cells have been stimulated by specific antigens.7 Patterns of restricted TCR Vß gene expression have been described in studies of multiple sclerosis,8 inflammatory myopathies,9-16 psoriasis,17 and Sjögrens syndrome18; whereas other studies of MS,19 rheumatoid arthritis,20 and anti-Hu paraneoplastic encephalomyelitis/sensory neuronopathy7 have indicated a more heterogeneous TCR Vß utilization of T cells in situ.
We used a panel of TCR Vß specific monoclonal antibodies on cryosections of sural nerve biopsy specimens from patients with CIDP or nonsystemic vasculitic neuropathy, as well as from control patients with chronic idiopathic axonal polyneuropathy (CIAP) and autopsy controls. The results were compared with PCR analysis of Vß gene family utilization and matched with peripheral blood T lymphocyte populations. In individual cases, nucleotide sequence analysis of Vß regions was performed.
| Patients and methods. |
|---|
|
|
|---|
|

(pan-
/
T cell receptor, 1:200; PharMingen, San Diego, CA). As secondary antibody, biotinylated goat anti-rabbit IgG or horse anti-mouse IgG (1:220, Vector Labs, Burlingame, CA) was used. Labeling was visualized by the avidin:biotinylated enzyme complex (ABC) method (Vector Labs). Color was developed using diaminobenzidine with cobalt and nickel intensification, and sections were counterstained with nuclear fast red. Omitting the primary antibody and incubating with some of the anti-Vß antibodies mentioned above did not produce any staining. As CD4 can also be expressed on macrophages,25 CD4+ cells were examined but not quantified. In order to calculate the percentage of Vß-positive cells in the entire T cell population, each section incubated with a specific Vß-antibody (or CD8-antibody or 
-antibody) was compared with a consecutive section incubated with the anti-CD3-antibody ( figure 1).
|

+ T cells as: (
+ cells / CD3+ cells) x 100%. We calculated the percentage of endoneurial CD3+ cells as: (endoneurial CD3+ cells / total CD3+ cells) x 100%. To obtain reliable numbers of Vß positive cells, the whole staining procedure was repeated, up to a maximum of four times, until approximately 100 CD3+ cells in the total sural nerve area had been counted for each patient. Fluorescence-activated cell sorter (FACS) analysis. Peripheral blood mononuclear cells of patients and four healthy donors were isolated from heparin blood by Ficoll gradient separation. The TCR Vß gene products were analyzed after stepwise incubation with unlabeled anti-Vß monoclonal antibody (1:20, Beckman Coulter, Fullerton, CA), fluorescein isothiocyanate (FITC)-labeled-goat-anti-mouse IgG (1:80, Becton-Dickinson, Franklin Lakes, NJ), mouse serum and phycoerythrin-labeled anti-CD3 (1:2, Becton-Dickinson). The cells were then subjected to two-color analysis using FACScan flow cytometer (Becton-Dickinson). All results were expressed as percentage of CD3+ cells.
Reverse-transcription PCR.
Because the panel of Vß-antibodies used in the immunohistochemical analysis covered only approximately 39% of the entire T cell population in blood (Beckman Coulter, Fullerton, CA), a reverse-transcription PCR with 25 Vß-family specific primers was carried out to further analyze TCR Vß gene utilization in the sural nerve biopsy specimens and peripheral blood lymphocytes. RNA extraction and cDNA synthesis were performed using standard methods.26,27 PCR amplification of cDNA was performed with a Cß reverse primer (sequence: CTCCTTCCCATTCACCCACCAGCTCAGCTC) in combination with a specific forward primer for each of the following Vß TCR: Vß1 to Vß4, Vß5a (recognizes family members 5.1 and 5.4), Vß5b (recognizes family members 5.2 and 5.3), Vß6 to Vß24, and Vß26. Control PCR amplifications for actin, hypoxanthine-guanine phosphoribosyltranferase (HPRT), TCR C
, and TCR Cß were performed with each sample to confirm cDNA integrity. A negative control reaction (no cDNA) was systematically run in each experiment. PCR amplification was carried out for 35 cycles under the following conditions: denaturation (94 °C for 30 seconds), annealing (60 °C for 45 seconds), and elongation (72 °C for 60 seconds). The PCR amplification reaction was performed for a second time for each Vß with another Cß primer (sequence: CACAAACTCGGTAGTCTTCGTCTCTACAGGGTGTGGGT) as reverse primer. The PCR products were run on 2% agarose gels, blotted onto a nitrocellulose membrane and hybridized with a 32p end-labeled Cß probe (sequence GAGGACCTGAAAAACGTGTTC). The blots were exposed to x-ray film for 4 to 18 hours.
Sequence analysis. To establish whether the expanded TCR Vß+ T cell populations were monoclonal, oligoclonal, or polyclonal, PCR products were subjected to nucleotide sequence analysis. To that end, PCR products were ligated into the pGEM-1 Vector (Promega, Madison, WI) and transfected into the Escherichia coli strain XL1-Blue. Clones containing inserts of the correct size were sequenced using the 373 DNA sequencer (Applied Biosystems, Weiterstadt, Germany).
Statistical analysis. The Mann-Whitney U test was used to compare percentages of the TCR Vß utilization of each Vß between patients with CIDP and autopsy controls, and between patients with vasculitic neuropathy and autopsy controls.
Results.
Immunohistochemical analysis of Vß utilization in sural nerve.
The total number of T cells and the percentage of T cells with a specific TCR Vß for the total sural nerve section of each patient are presented in table 2. The panel of Vß antibodies detected between 15% and 58% of the CD3+ T cell population in the sural nerve biopsy specimens. The TCR Vß utilization in the sural nerve biopsy specimen was heterogeneous in all patients and controls analyzed. No specific Vß family was dominant or persistently absent in any of the patient groups or controls, and differences in percentages of each Vß between patients with CIDP or vasculitic neuropathy and autopsy controls were not significant. In particular, in Patients 1 through 4 with CIDP, who had a higher number of T cells than the noninflammatory controls, there was no overrepresentation of a specific Vß family. Only in Patient 14, who had a vasculitic neuropathy and a highly increased number of infiltrating T cells, did the percentage of Vß13.6+ T cells appear to be increased (15%) compared with percentages of Vß 13.6 found in peripheral blood lymphocytes (2%). In this patient, nucleotide sequence analysis on Vß13 was performed (see below). The distribution of TCR Vß gene families was similar in the epineurium and endoneurium in all patients and controls. The percentage of endoneurial T cells in patients with CIDP ranged from 8 to 47% (median 22); in patients with vasculitic neuropathy, from 4 to 31% (median 5%); in patients with CIAP, from 14 to 40% (median 17%); and in autopsy controls, from 14 to 62% (median 22%). The percentage of CD8+ T cells in patients with CIDP ranged from 37 to 96% (median 51%); in patients with vasculitic neuropathy, from 33 to 43% (mean 38%); in patients with CIAP, from 33 to 100% (median 71%); and in autopsy controls, from 35 to 63% (median 60%). The percentage of 
+ T cells in patients with CIDP ranged from 0 to 10% (median 1%); in patients with vasculitic neuropathy, from 0 to 1% (median 1%); in patients with CIAP, from 0 to 2% (median 0%); and in autopsy controls, from 0 to 4% (median 0%).
|
PCR analysis of Vß utilization in sural nerve and peripheral blood. With the Vß primers and the PCR protocol used in our study, we were able to detect expression of all TCR Vß gene families in peripheral blood of patients and healthy donors, except for Vß20 in Patient 15 and Vß23 in Patient 21. The results of the PCR analysis of the sural nerves and peripheral blood lymphocytes for patients and controls are shown in figure 2. The Vß gene utilization was heterogeneous in all patients and controls. We found a wider array of Vß families expressed in the patients with CIDP and vasculitic neuropathy than in the controls noninflammatory disease. Compared with the immunohistochemical analysis, the results were conflicting: some Vß genes were not used according to the PCR analysis, whereas T cells with the same TCR Vß were found in the sural nerve sections and vice versa (see table 2 and figure 2).
|
| Discussion. |
|---|
|
|
|---|
In contrast to our results in inflammatory neuropathy, previous studies in inflammatory myopathies were indicative for restriction of the utilization of the TCR Vß when investigated with immunohistochemical methods,9,12,15 or PCR analysis.11,13,14,16 Collectively, a heterogeneous utilization of the TCR Vß was found. In multiple sclerosis, the TCR Vß repertoire in brain lesions was restricted in one immunohistochemical study,8 and heterogeneous with PCR analysis in another study.19 The TCR Vß repertoire of affected tissue has never been investigated using the combination of immunohistochemical and PCR analysis with all available antibodies and primers. Both the immunohistochemical and PCR approaches have advantages and limitations. With anti-TCR antibodies it is possible to quantify and localize TCR Vß positive T cells, but the panel of antibodies that performed well in immunohistochemical analysis of sural nerve biopsy specimens comprised only approximately 39% of the Vß genes used in peripheral T cell populations. The PCR primers comprise the entire T cell population, and the tissue specimen analyzed is larger than the sural nerve sections used in immunohistochemical analysis, but quantification and localization of T cells is not possible. With PCR analysis, not all TCR Vß genes were positive, which could be interpreted as restriction of TCR Vß utilization. However, in noninflammatory and normal controls, even fewer TCR Vß genes were positive, which is not likely to be due to clonal expansion of disease-related T cells. Moreover, the results of the PCR analysis do not correspond to the immunohistochemical analysis. It is unlikely that these conflicting results can be explained by false positivity in the immunohistochemical analysis due to cross-reactions of the anti-Vß antibodies, as the percentages of the Vß utilization are similar to the percentages obtained from flow cytometric analysis of peripheral blood lymphocytes. An explanation could be a methodological failure of the PCR method, but the consistent detection of the entire TCR repertoire in the peripheral blood lymphocyte samples confirmed the integrity of the TCR primer sequences used in this assay. It is still possible that the results of PCR analysis on T cells are not reliable due to a factor concerning the characteristics of the tissue specimen or its preparation. A second explanation might be that the total number of T cells in the nerve biopsy specimens affected the number of positive Vß genes detected in the PCR analysis, as positivity was highest in the vasculitis group and lowest in the noninflammatory controls. However, this cannot be the only explanation, as the correlation between number of T cells in the biopsies and PCR Vß gene positivity within the groups of patients with vasculitis, CIDP or CIAP was not consistent. For example, in the patient (Patient 14) with most T cells per sural nerve section and a heterogeneous utilization of Vß receptor in the immunohistochemical analysis, a majority of the PCR Vß genes were negative. Similar results were obtained in a previous study on the TCR Vß repertoire in MS plaques: the Vß repertoire in normal controls seemed more restricted compared with acute MS lesions. The authors of this previous study concluded that this might be due to fewer T cells or minute quantities of TCR mRNA in the controls; but in their study, the number of T cells did not fully correlate with the number of positive TCR.19 Moreover, in another study on the TCR Vß of cerebrospinal fluid T cells, PCR analysis of the TCR Vß repertoire showed negative results in some patients, whereas in other patients with the same number of T cells the results were positive.28 It might be that the amount of mRNA from nerve tissue is so minute that suboptimal amplification of the different rearranged Vß genes produces a negative result. A final explanation might be that TCR mRNA in the nerve tissue has already disappeared, whereas the TCR protein was still detectable. From these results one may conclude that restricted positive results of PCR analysis of the TCR Vß regions requires careful interpretation.
The results of our study may reflect nonspecific recruitment of T cells from peripheral blood T lymphocytes to the peripheral nervous system during the course of the inflammatory response. The presence of nonspecific T cells in the peripheral nerve tissue is in accordance with the finding that T cells are also found in patients with noninflammatory neuropathies and normal controls.4 Activated nonspecific T cells may help B cells to produce antibodies against peripheral nerve components, thereby inducing activation of either complement or antibody-dependent cytolytic cells.29,30 In CIDP, however, there is not much evidence for a B cell or antibody mediated process.31-33 Another function of nonspecific T cells may be to increase the bloodnerve barrier permeability and recruit macrophages, as has been hypothesized in experimental model of inflammatory neuropathy in Lewis rats.34,35 Local accumulation of high numbers of non-neural T cells induced severe axonal degeneration and conduction failure, while lower numbers induced conduction block and mild demyelination. Neural damage could be induced by soluble proinflammatory mediators released by T cells and macrophages which could damage susceptible Schwann cells first, and then axons. However, it is also possible that T cells present at the time the biopsy was taken have a suppressive function in CIDP. In vasculitic neuropathy, it is possible that after damage of the blood vessels by immune complex deposition or cytotoxic T cells,6,24,36,37 T cells are attracted nonspecifically into the nervous tissue.
Conversely, it should be noted that the lack of detectable shifts in the TCR Vß repertoire between blood and nerve compartments does not necessarily exclude the causative involvement of T cells in peripheral nerve.38 At least five reasons why antigen-driven selection of certain TCR are difficult to unveil, can be given: 1) the majority of infiltrating T cells in nerve may not recognize antigen, thus masking the antigen-specific population; 2) larger sized antigens might comprise multiple epitopes that are recognized by different TCR, thus leading to the presence of a multiclonal T cell population; 3) even a given epitope might activate T cells characterized by different receptors depending on the antigen presenting molecule(s)38,39; 4) at the time the biopsy was taken, antigen-specific T cells may already have disappeared; and 5) the major pathology in CIDP is within proximal portions of the peripheral nervous system, and the findings in the sural nerve at ankle level may not reflect the active process more proximally.
The heterogeneous Vß gene utilization makes it impossible to design a single broadly effective immunotherapy that targets the Vß gene product. Further analysis of the TCR by investigating the V
chain will have limited results because not many antibodies to the V
chain are available, the V
chain is homogeneous in combination with the Vß chain in clonal expansion, and recognition of superantigen is independent of the V
chain.
Investigation of Vß TCR utilization by immunohistochemical analysis, reverse-transcription PCR, and nucleotide sequence analysis in sural nerve, and flow cytometric analysis in blood did not provide evidence for predominant TCR Vß utilization in CIDP or vasculitic neuropathy.
| Acknowledgments |
|---|
The authors thank H. Veldman for laboratory assistance.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
N. Schwab, C. G. Bien, A. Waschbisch, A. Becker, G. H. Vince, K. Dornmair, and H. Wiendl CD8+ T-cell clones dominate brain infiltrates in Rasmussen encephalitis and persist in the periphery Brain, May 1, 2009; 132(5): 1236 - 1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Koller, B. C. Kieseier, S. Jander, and H.-P. Hartung Chronic Inflammatory Demyelinating Polyneuropathy N. Engl. J. Med., March 31, 2005; 352(13): 1343 - 1356. [Full Text] [PDF] |
||||
![]() |
B. C. Kieseier, M. C. Dalakas, and H.-P. Hartung Immune mechanisms in chronic inflammatory demyelinating neuropathy Neurology, December 24, 2002; 59(90126): S7 - 12. [Abstract] [Full Text] |
||||
![]() |
T.H. Brannagan III, A. Pradhan, T. Heiman-Patterson, A.C. Winkelman, M.J. Styler, D.L. Topolsky, P.A. Crilley, R.J. Schwartzman, I. Brodsky, and D.E. Gladstone High-dose cyclophosphamide without stem-cell rescue for refractory CIDP Neurology, June 25, 2002; 58(12): 1856 - 1858. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |