Neurology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Suppl
Right arrow Data Suppl
Right arrow Correspondence:
Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when Correspondence are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bosboom, W.M.J.
Right arrow Articles by Logtenberg, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bosboom, W.M.J.
Right arrow Articles by Logtenberg, T.
Related Collections
Right arrow All Immunology
Right arrow Vasculitis
Right arrow All Neuromuscular Disease
Right arrow Peripheral neuropathy
Right arrow Chronic inflammatory demyelinating polyneuropathy
Neurology 2001;56:74-81
© 2001 American Academy of Neurology


Articles

Sural nerve T-cell receptor Vß gene utilization in chronic inflammatory demyelinating polyneuropathy and vasculitic neuropathy

W.M.J. Bosboom, MD, PhD;, L.H. Van den Berg, MD, PhD;, I. Mollee;, L.D. Sasker;, J. Jansen, PhD;, J.H.J. Wokke, MD, PhD; and T. Logtenberg, PhD

From the Department of Neurology of the Rudolf Magnus Institute for Neurosciences (Drs. Bosboom, Van den Berg, and Wokke, I. Mollee, L.D. Sasker, and J. Jansen); and the Department of Immunology (T. Logtenberg), University Medical Center Utrecht, the Netherlands.

Address correspondence and reprint requests to Dr. Leonard H. van den Berg, Department of Neurology, University Medical Center Utrecht, P.O. Box 85500, 3508 GA Utrecht, the Netherlands; e-mail: l.h.vandenberg{at}neuro.azu.nl


    Article Abstract
 Top.
 Article Abstract
 Introduction
 Patients and methods.
 Discussion.
 References
 
Objective: To investigate the utilization of T-cell receptor (TCR) variable (V) regions in infiltrates of sural nerve biopsies of patients with chronic inflammatory demyelinating polyneuropathy (CIDP) and vasculitic neuropathy. Background: The presence of infiltrating T lymphocytes in sural nerve biopsies may suggest a T cell-mediated immune mechanism in the pathogenesis of CIDP and vasculitic neuropathy. Patients and methods: The utilization of TCR Vß regions in sural nerves of 13 patients with CIDP and five patients with vasculitic neuropathy was determined by immunohistochemistry, reverse-transcription PCR, and nucleotide sequence analysis. These techniques were also applied in four patients with chronic idiopathic axonal polyneuropathy (CIAP) who acted as noninflammatory controls, and in five autopsy controls. Results: The TCR Vß utilization of infiltrating T cells in sural nerves of patients with CIDP, vasculitic neuropathy, and noninflammatory controls is heterogeneous. A dominant TCR Vß utilization was not found in any of the patients or controls. Conclusion: There is no evidence for the presence of clonally expanded T cells in sural nerves of patients with CIDP and vasculitic neuropathy.


    Introduction
 Top.
 Article Abstract
 Introduction
 Patients and methods.
 Discussion.
 References
 
Evidence for a pathogenic role of T cells in chronic inflammatory demyelinating polyneuropathy (CIDP) includes an increased frequency of circulating activated peripheral T cells,1,2 and elevated serum levels of interleukine-2 (Il-2) and soluble Il-2 receptors.3 In both CIDP and vasculitic neuropathy, increased numbers of T cells in the sural nerve biopsy specimens may indicate a role for T cells in the disease mechanism.4-6 It is currently not clear whether sural nerve T cells, their numbers increased or not, are disease-specific autoreactive T cells, or whether these are attracted nonspecifically to the peripheral nervous tissue.

Analysis of T-cell receptors (TCR) in affected tis-sue may show 1) a broad TCR repertoire without Vß family overrepresentation (similar to that found in peripheral blood or normal lymph nodes), indicating that the T cells have been attracted nonspecifically by a proinflammatory environment; 2) a restricted TCR repertoire with Vß family overrepresentation but without evidence of clonal expansion, indicating that there may be a superantigen-driven T cell expansion; or 3) a restricted TCR repertoire with Vß family overrepresentation and clonal expansion, indicating that the T cells have been stimulated by specific antigens.7 Patterns of restricted TCR Vß gene expression have been described in studies of multiple sclerosis,8 inflammatory myopathies,9-16 psoriasis,17 and Sjögren’s syndrome18; whereas other studies of MS,19 rheumatoid arthritis,20 and anti-Hu paraneoplastic encephalomyelitis/sensory neuronopathy7 have indicated a more heterogeneous TCR Vß utilization of T cells in situ.

We used a panel of TCR Vß specific monoclonal antibodies on cryosections of sural nerve biopsy specimens from patients with CIDP or nonsystemic vasculitic neuropathy, as well as from control patients with chronic idiopathic axonal polyneuropathy (CIAP) and autopsy controls. The results were compared with PCR analysis of Vß gene family utilization and matched with peripheral blood T lymphocyte populations. In individual cases, nucleotide sequence analysis of Vß regions was performed.


    Patients and methods.
 Top.
 Article Abstract
 Introduction
 Patients and methods.
 Discussion.
 References
 
Patients. We investigated sural nerve biopsies, taken between 1990 and 1997 from 13 patients who fulfilled established criteria for CIDP,21 and five patients with nonsystemic vasculitic neuropathy and sural nerve involvement. None of the patients had received treatment prior to the biopsy being taken, except for Patients 8 and 13, both of whom had received intravenous immunoglobulins a few months previously. For normal controls we used five sural nerves from autopsy patients without a known peripheral nerve disease. For disease controls we used four sural nerves from patients with a noninflammatory chronic idiopathic axonal polyneuropathy (CIAP). CIAP has a slowly progressive course, and during a 5-year follow-up no cause was found.22,23 Clinical data of patients are listed in table 1. Biopsy findings were not used to assign diagnoses except in cases of vasculitis, for which well-established morphological criteria exist.24 Eleven patients with CIDP, one patient with CIAP, all patients with vasculitis, and one normal control were consecutively included in this study. Two patients with CIDP (Patients 1 and 2), three patients with CIAP (Patients 19, 20, 21), and four autopsy controls (Patients 23 through 26) were selected because of their relatively high number of T cells in the total sural nerve area, as reported in our previous study.4


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical, laboratory, and pathologic patient data
 
Immunohistochemistry. Immunohistochemical staining was performed on 6 µm-thick transverse acetone-fixed frozen sections of sural nerves, as well as on sections of tonsil as a positive control. As antibodies against the variable part of the ß-chain of the T cell receptor (anti-Vß-antibodies) were not yet regularly used for immunohistochemistry, these antibodies were first tested on tonsil, muscle, and nerve with extensive infiltrates of T cells. The anti-Vß-antibodies tested were monoclonal antibodies raised in mice and included anti-Vß2-(IgG1), Vß3-(IgG2a), Vß5.1-(IgG2a), Vß5.2-(IgG1), Vß5.3-(IgG1), Vß6-(IgM), Vß8-(IgG2a), Vß9-(IgG2a), Vß11-(IgG2a), Vß12-(IgG2a), Vß13.1-(IgG2b), Vß13.6-(IgG1), Vß14-(IgG1), Vß16-(IgG1), Vß17-(IgG1), Vß18-(IgG1), Vß20-(IgG), Vß21-(IgG2a), Vß22-(IgG1), and Vß23-(IgG1) antibodies (Beckman Coulter, Fullerton, CA). The optimal dilutions were determined for each Vß-antibody. Insufficient or no staining in control tissues was observed with anti-Vß5.2-, Vß5.3-, Vß6-, Vß9-, Vß11-, Vß13.1-, Vß18-, and Vß20-antibodies. The anti-Vß3-antibody specifically stained T cells in tonsil and muscle, but the background staining in nerve was unacceptably high. The anti-Vß-antibodies which gave reliable staining and were used for further analysis were anti-Vß2-(1:200), Vß5.1- (1:100), Vß8-(1:100), Vß12-(1:200), Vß13.6-(1:50), Vß14- (1:25), Vß16-(1:50), Vß17-(1:50), Vß21-(1:200), Vß22-(1:50), and Vß23-(1:50) antibodies. For further characterization of infiltrating cells, consecutive sections were incubated with the following primary antibodies diluted in phosphate-buffered saline (PBS) with 5% horse or goat serum: rabbit-anti-CD3 (Pan-T cells, 1:200; DAKO, Carpinteria, CA), mouse-anti-CD4 (helper/inducer T cells, 1:40; DAKO), mouse-anti-CD8 (cytotoxic/suppressor T cells, 1:400; DAKO), mouse-anti-CD20 (B cells, 1:200; DAKO), and mouse-anti-{gamma}{delta} (pan-{gamma}/{delta} T cell receptor, 1:200; PharMingen, San Diego, CA). As secondary antibody, biotinylated goat anti-rabbit IgG or horse anti-mouse IgG (1:220, Vector Labs, Burlingame, CA) was used. Labeling was visualized by the avidin:biotinylated enzyme complex (ABC) method (Vector Labs). Color was developed using diaminobenzidine with cobalt and nickel intensification, and sections were counterstained with nuclear fast red. Omitting the primary antibody and incubating with some of the anti-Vß antibodies mentioned above did not produce any staining. As CD4 can also be expressed on macrophages,25 CD4+ cells were examined but not quantified. In order to calculate the percentage of Vß-positive cells in the entire T cell population, each section incubated with a specific Vß-antibody (or CD8-antibody or {gamma}{delta}-antibody) was compared with a consecutive section incubated with the anti-CD3-antibody ( figure 1).



View larger version (112K):
[in this window]
[in a new window]
 
Figure 1. Consecutive transverse sections of the sural nerve of Patient 3 with (A) anti-CD3-staining and (B) anti-Vß17-staining. Bar = 50 µm.

 
Quantification of T cells. T cells were quantified by light microscopy (40x objective). Numbers of CD3+, CD8+, CD20+, and all Vß+ T cells were measured in the total endoneurial and epineurial area. In the total sural nerve areas, the endoneurial areas, and the epineurial areas, we calculated the percentages of specific Vß+ cells as: (Vßn+ cells / CD3+ cells) x 100%; of CD8+ T cells as: (CD8+ cells / CD3+ cells) x 100%; of {gamma}{delta}+ T cells as: ({gamma}{delta}+ cells / CD3+ cells) x 100%. We calculated the percentage of endoneurial CD3+ cells as: (endoneurial CD3+ cells / total CD3+ cells) x 100%. To obtain reliable numbers of Vß positive cells, the whole staining procedure was repeated, up to a maximum of four times, until approximately 100 CD3+ cells in the total sural nerve area had been counted for each patient.

Fluorescence-activated cell sorter (FACS) analysis. Peripheral blood mononuclear cells of patients and four healthy donors were isolated from heparin blood by Ficoll gradient separation. The TCR Vß gene products were analyzed after stepwise incubation with unlabeled anti-Vß monoclonal antibody (1:20, Beckman Coulter, Fullerton, CA), fluorescein isothiocyanate (FITC)-labeled-goat-anti-mouse IgG (1:80, Becton-Dickinson, Franklin Lakes, NJ), mouse serum and phycoerythrin-labeled anti-CD3 (1:2, Becton-Dickinson). The cells were then subjected to two-color analysis using FACScan flow cytometer (Becton-Dickinson). All results were expressed as percentage of CD3+ cells.

Reverse-transcription PCR. Because the panel of Vß-antibodies used in the immunohistochemical analysis covered only approximately 39% of the entire T cell population in blood (Beckman Coulter, Fullerton, CA), a reverse-transcription PCR with 25 Vß-family specific primers was carried out to further analyze TCR Vß gene utilization in the sural nerve biopsy specimens and peripheral blood lymphocytes. RNA extraction and cDNA synthesis were performed using standard methods.26,27 PCR amplification of cDNA was performed with a Cß reverse primer (sequence: CTCCTTCCCATTCACCCACCAGCTCAGCTC) in combination with a specific forward primer for each of the following Vß TCR: Vß1 to Vß4, Vß5a (recognizes family members 5.1 and 5.4), Vß5b (recognizes family members 5.2 and 5.3), Vß6 to Vß24, and Vß26. Control PCR amplifications for actin, hypoxanthine-guanine phosphoribosyltranferase (HPRT), TCR C{alpha}, and TCR Cß were performed with each sample to confirm cDNA integrity. A negative control reaction (no cDNA) was systematically run in each experiment. PCR amplification was carried out for 35 cycles under the following conditions: denaturation (94 °C for 30 seconds), annealing (60 °C for 45 seconds), and elongation (72 °C for 60 seconds). The PCR amplification reaction was performed for a second time for each Vß with another Cß primer (sequence: CACAAACTCGGTAGTCTTCGTCTCTACAGGGTGTGGGT) as reverse primer. The PCR products were run on 2% agarose gels, blotted onto a nitrocellulose membrane and hybridized with a 32p end-labeled Cß probe (sequence GAGGACCTGAAAAACGTGTTC). The blots were exposed to x-ray film for 4 to 18 hours.

Sequence analysis. To establish whether the expanded TCR Vß+ T cell populations were monoclonal, oligoclonal, or polyclonal, PCR products were subjected to nucleotide sequence analysis. To that end, PCR products were ligated into the pGEM-1 Vector (Promega, Madison, WI) and transfected into the Escherichia coli strain XL1-Blue. Clones containing inserts of the correct size were sequenced using the 373 DNA sequencer (Applied Biosystems, Weiterstadt, Germany).

Statistical analysis. The Mann-Whitney U test was used to compare percentages of the TCR Vß utilization of each Vß between patients with CIDP and autopsy controls, and between patients with vasculitic neuropathy and autopsy controls.

Results. Immunohistochemical analysis of Vß utilization in sural nerve. The total number of T cells and the percentage of T cells with a specific TCR Vß for the total sural nerve section of each patient are presented in table 2. The panel of Vß antibodies detected between 15% and 58% of the CD3+ T cell population in the sural nerve biopsy specimens. The TCR Vß utilization in the sural nerve biopsy specimen was heterogeneous in all patients and controls analyzed. No specific Vß family was dominant or persistently absent in any of the patient groups or controls, and differences in percentages of each Vß between patients with CIDP or vasculitic neuropathy and autopsy controls were not significant. In particular, in Patients 1 through 4 with CIDP, who had a higher number of T cells than the noninflammatory controls, there was no overrepresentation of a specific Vß family. Only in Patient 14, who had a vasculitic neuropathy and a highly increased number of infiltrating T cells, did the percentage of Vß13.6+ T cells appear to be increased (15%) compared with percentages of Vß 13.6 found in peripheral blood lymphocytes (2%). In this patient, nucleotide sequence analysis on Vß13 was performed (see below). The distribution of TCR Vß gene families was similar in the epineurium and endoneurium in all patients and controls. The percentage of endoneurial T cells in patients with CIDP ranged from 8 to 47% (median 22); in patients with vasculitic neuropathy, from 4 to 31% (median 5%); in patients with CIAP, from 14 to 40% (median 17%); and in autopsy controls, from 14 to 62% (median 22%). The percentage of CD8+ T cells in patients with CIDP ranged from 37 to 96% (median 51%); in patients with vasculitic neuropathy, from 33 to 43% (mean 38%); in patients with CIAP, from 33 to 100% (median 71%); and in autopsy controls, from 35 to 63% (median 60%). The percentage of {gamma}{delta}+ T cells in patients with CIDP ranged from 0 to 10% (median 1%); in patients with vasculitic neuropathy, from 0 to 1% (median 1%); in patients with CIAP, from 0 to 2% (median 0%); and in autopsy controls, from 0 to 4% (median 0%).


View this table:
[in this window]
[in a new window]
 
Table 2. Number of CD3+ cells and percentages of T-cell receptor Vß utilization in total sural nerve sections (immunohistochemistry)
 
Comparison of Vß utilization in sural nerve biopsy specimens and peripheral blood. The percentages of TCR Vß utilization of T cells in sural nerve biopsy specimen of patients with CIDP, CIAP, and vasculitic neuropathy were compared with TCR Vß utilization in peripheral blood to find evidence for expansion of T cells in nerves. The TCR Vß utilization in the sural nerve biopsies compared with the peripheral blood lymphocytes showed only a mild increase of TCR Vß8 in Patient 8 (11% versus 4%) and Patient 12 (9 versus 3%) with CIDP; of Vß13.6 in Patient 13 with CIDP (10 versus 1%) and Patient 14 with vasculitis (15 versus <1%); and of Vß17 in Patient 12 with CIDP (11 versus 5%).

PCR analysis of Vß utilization in sural nerve and peripheral blood. With the Vß primers and the PCR protocol used in our study, we were able to detect expression of all TCR Vß gene families in peripheral blood of patients and healthy donors, except for Vß20 in Patient 15 and Vß23 in Patient 21. The results of the PCR analysis of the sural nerves and peripheral blood lymphocytes for patients and controls are shown in figure 2. The Vß gene utilization was heterogeneous in all patients and controls. We found a wider array of Vß families expressed in the patients with CIDP and vasculitic neuropathy than in the controls noninflammatory disease. Compared with the immunohistochemical analysis, the results were conflicting: some Vß genes were not used according to the PCR analysis, whereas T cells with the same TCR Vß were found in the sural nerve sections and vice versa (see table 2 and figure 2).



View larger version (94K):
[in this window]
[in a new window]
 
Figure 2. Vß T-cell receptor utilization in sural nerve and peripheral blood of patients and controls (PCR). Pat = patient; CIDP = chronic inflammatory demyelinating polyneuropathy; Vasc. = vasculitic neuropathy; CIAP = chronic idiopathic axonal polyneuropathy; Normal = autopsy control; H = healthy control.

 
Nucleotide sequence analysis. In the biopsy of Patient 14 with a vasculitic neuropathy, the percentage of Vß13.6+ T cells appeared to be increased. To determine whether this increase was the result of a monoclonal expansion of T cells, RNA was extracted from the biopsy and used for first strand cDNA synthesis and PCR. The Vß13 PCR fragments were cloned and subjected to nucleotide sequence analysis. Among 13 randomly sequenced inserts, four Vß13 regions, as evaluated by the CDR3 region, were unique: three Vß13 regions were found twice and one Vß13 region was found three times. We conclude that the increased Vß13.6 frequency in the biopsy of this patient could not be attributed to a monoclonal expansion of T cells. Similarly, we analyzed collections of TCR Vß4 in Patient 10 and TCR Vß9 in Patient 12, based on the observation that a strong band was found in the PCR analysis compared with the other Vß bands. Again no evidence for monoclonality was found, as a maximum of two recurrent CDR3 regions were found in 16 and nine inserts. Also, in a normal control (Patient 27), we found a recurrent Vß4 CDR3 region twice among seven inserts.


    Discussion.
 Top.
 Article Abstract
 Introduction
 Patients and methods.
 Discussion.
 References
 
We have characterized TCR Vß gene expression in infiltrating T cells in sural nerve biopsy specimens of patients with CIDP, vasculitic neuropathy, CIAP, and normal controls. TCR Vß gene expression was determined by immunohistochemistry using a panel of monoclonal antibodies specific for different TCR Vß gene products. These results were compared with PCR analysis of the TCR Vß of T cells in these biopsies, and with flow cytometric and PCR analysis of TCR Vß utilization in peripheral blood lymphocytes. The TCR Vß utilization was heterogeneous in all patient groups, and no single Vß gene family was consistently overrepresented. Only the utilization of the TCR Vß13.6 in one patient with vasculitic neuropathy was mildly increased, but with nucleotide sequence analysis no evidence of monoclonal expansion of these T cells was found.

In contrast to our results in inflammatory neuropathy, previous studies in inflammatory myopathies were indicative for restriction of the utilization of the TCR Vß when investigated with immunohistochemical methods,9,12,15 or PCR analysis.11,13,14,16 Collectively, a heterogeneous utilization of the TCR Vß was found. In multiple sclerosis, the TCR Vß repertoire in brain lesions was restricted in one immunohistochemical study,8 and heterogeneous with PCR analysis in another study.19 The TCR Vß repertoire of affected tissue has never been investigated using the combination of immunohistochemical and PCR analysis with all available antibodies and primers. Both the immunohistochemical and PCR approaches have advantages and limitations. With anti-TCR antibodies it is possible to quantify and localize TCR Vß positive T cells, but the panel of antibodies that performed well in immunohistochemical analysis of sural nerve biopsy specimens comprised only approximately 39% of the Vß genes used in peripheral T cell populations. The PCR primers comprise the entire T cell population, and the tissue specimen analyzed is larger than the sural nerve sections used in immunohistochemical analysis, but quantification and localization of T cells is not possible. With PCR analysis, not all TCR Vß genes were positive, which could be interpreted as restriction of TCR Vß utilization. However, in noninflammatory and normal controls, even fewer TCR Vß genes were positive, which is not likely to be due to clonal expansion of disease-related T cells. Moreover, the results of the PCR analysis do not correspond to the immunohistochemical analysis. It is unlikely that these conflicting results can be explained by false positivity in the immunohistochemical analysis due to cross-reactions of the anti-Vß antibodies, as the percentages of the Vß utilization are similar to the percentages obtained from flow cytometric analysis of peripheral blood lymphocytes. An explanation could be a methodological failure of the PCR method, but the consistent detection of the entire TCR repertoire in the peripheral blood lymphocyte samples confirmed the integrity of the TCR primer sequences used in this assay. It is still possible that the results of PCR analysis on T cells are not reliable due to a factor concerning the characteristics of the tissue specimen or its preparation. A second explanation might be that the total number of T cells in the nerve biopsy specimens affected the number of positive Vß genes detected in the PCR analysis, as positivity was highest in the vasculitis group and lowest in the noninflammatory controls. However, this cannot be the only explanation, as the correlation between number of T cells in the biopsies and PCR Vß gene positivity within the groups of patients with vasculitis, CIDP or CIAP was not consistent. For example, in the patient (Patient 14) with most T cells per sural nerve section and a heterogeneous utilization of Vß receptor in the immunohistochemical analysis, a majority of the PCR Vß genes were negative. Similar results were obtained in a previous study on the TCR Vß repertoire in MS plaques: the Vß repertoire in normal controls seemed more restricted compared with acute MS lesions. The authors of this previous study concluded that this might be due to fewer T cells or minute quantities of TCR mRNA in the controls; but in their study, the number of T cells did not fully correlate with the number of positive TCR.19 Moreover, in another study on the TCR Vß of cerebrospinal fluid T cells, PCR analysis of the TCR Vß repertoire showed negative results in some patients, whereas in other patients with the same number of T cells the results were positive.28 It might be that the amount of mRNA from nerve tissue is so minute that suboptimal amplification of the different rearranged Vß genes produces a negative result. A final explanation might be that TCR mRNA in the nerve tissue has already disappeared, whereas the TCR protein was still detectable. From these results one may conclude that restricted positive results of PCR analysis of the TCR Vß regions requires careful interpretation.

The results of our study may reflect nonspecific recruitment of T cells from peripheral blood T lymphocytes to the peripheral nervous system during the course of the inflammatory response. The presence of nonspecific T cells in the peripheral nerve tissue is in accordance with the finding that T cells are also found in patients with noninflammatory neuropathies and normal controls.4 Activated nonspecific T cells may help B cells to produce antibodies against peripheral nerve components, thereby inducing activation of either complement or antibody-dependent cytolytic cells.29,30 In CIDP, however, there is not much evidence for a B cell or antibody mediated process.31-33 Another function of nonspecific T cells may be to increase the blood–nerve barrier permeability and recruit macrophages, as has been hypothesized in experimental model of inflammatory neuropathy in Lewis rats.34,35 Local accumulation of high numbers of non-neural T cells induced severe axonal degeneration and conduction failure, while lower numbers induced conduction block and mild demyelination. Neural damage could be induced by soluble proinflammatory mediators released by T cells and macrophages which could damage susceptible Schwann cells first, and then axons. However, it is also possible that T cells present at the time the biopsy was taken have a suppressive function in CIDP. In vasculitic neuropathy, it is possible that after damage of the blood vessels by immune complex deposition or cytotoxic T cells,6,24,36,37 T cells are attracted nonspecifically into the nervous tissue.

Conversely, it should be noted that the lack of detectable shifts in the TCR Vß repertoire between blood and nerve compartments does not necessarily exclude the causative involvement of T cells in peripheral nerve.38 At least five reasons why antigen-driven selection of certain TCR are difficult to unveil, can be given: 1) the majority of infiltrating T cells in nerve may not recognize antigen, thus masking the antigen-specific population; 2) larger sized antigens might comprise multiple epitopes that are recognized by different TCR, thus leading to the presence of a multiclonal T cell population; 3) even a given epitope might activate T cells characterized by different receptors depending on the antigen presenting molecule(s)38,39; 4) at the time the biopsy was taken, antigen-specific T cells may already have disappeared; and 5) the major pathology in CIDP is within proximal portions of the peripheral nervous system, and the findings in the sural nerve at ankle level may not reflect the active process more proximally.

The heterogeneous Vß gene utilization makes it impossible to design a single broadly effective immunotherapy that targets the Vß gene product. Further analysis of the TCR by investigating the V{alpha} chain will have limited results because not many antibodies to the V{alpha} chain are available, the V{alpha} chain is homogeneous in combination with the Vß chain in clonal expansion, and recognition of superantigen is independent of the V{alpha} chain.

Investigation of Vß TCR utilization by immunohistochemical analysis, reverse-transcription PCR, and nucleotide sequence analysis in sural nerve, and flow cytometric analysis in blood did not provide evidence for predominant TCR Vß utilization in CIDP or vasculitic neuropathy.


    Acknowledgments
 
Supported by grants from the Netherlands Organization for Scientific Research, the Prinses Beatrix Fonds, and the Kröger Foundation. The research of L.H.V. was supported by a fellowship from the Royal Netherlands Academy of Arts and Sciences.

The authors thank H. Veldman for laboratory assistance.


    Footnotes
 
Additional material related to this article can be found on the Neurology Web site. Go to www.neurology.org and scroll down the Table of Contents for the January 9 issue to find the title link for this article.


    References
 Top.
 Article Abstract
 Introduction
 Patients and methods.
 Discussion.
 References
 

  1. Taylor WA, Hughes RA. T lymphocyte activation antigens in Guillain-Barré syndrome and chronic idiopathic demyelinating polyradiculoneuropathy. J Neuroimmunol 1989; 24: 33–39.[Medline]
  2. Van den Berg LH, Mollee I, Wokke JH, Logtenberg T. Increased frequencies of HPRT mutant T lymphocytes in patients with Guillain–Barré syndrome and chronic inflammatory demyelinating polyneuropathy: further evidence for a role of T cells in the etiopathogenesis of peripheral demyelinating diseases. J Neuroimmunol 1995; 58: 37–42.[Medline]
  3. Hartung HP, Hughes RA, Taylor WA, Heininger K, Reiners K, Toyka KV. T cell activation in Guillain–Barré syndrome and in MS: elevated serum levels of soluble IL–2 receptors. Neurology 1990; 40: 215–218.[Abstract/Free Full Text]
  4. Bosboom WMJ, Van den Berg LH, De Boer L, et al. The diagnostic value of sural nerve T cells in chronic inflammatory demyelinating polyneuropathy. Neurology 1999; 53: 837–845.[Abstract/Free Full Text]
  5. Engelhardt A, Lorler H, Neundorfer B. Immunohistochemical findings in vasculitic neuropathies. Acta Neurol Scand 1993; 87: 318–321.[Medline]
  6. Kissel JT, Riethman JL, Omerza J, Rammohan KW, Mendell ZR. Peripheral nerve vasculitis: immune characterization of the vascular lesions [see comments]. Ann Neurol 1989; 25: 291–297.[Medline]
  7. Voltz R, Dalmau J, Posner JB, Rosenfeld MR. T-cell receptor analysis in anti-Hu associated paraneoplastic encephalomyelitis. Neurology 1998; 51: 1146–1150.[Abstract/Free Full Text]
  8. Oksenberg JR, Panzara MA, Begovich AB, et al. Selection for T-cell receptor V beta-D beta-J beta gene rearrangements with specificity for a myelin basic protein peptide in brain lesions of multiple sclerosis. Nature 1993; 362: 68–70.[Medline]
  9. Bender A, Behrens L, Engel AG, Hohlfeld R. T-cell heterogeneity in muscle lesions of inclusion body myositis. J Neuroimmunol 1998; 84: 86–91.[Medline]
  10. Fyhr IM, Moslemi AR, Lindberg C, Oldfors A. T cell receptor beta-chain repertoire in inclusion body myositis. J Neuroimmunol 1998; 91: 129–134.[Medline]
  11. Fyhr IM, Moslemi AR, Tarkowski A, Lindberg C, Oldfors A. Limited T-cell receptor V gene usage in inclusion body myositis. Scand J Immunol 1996; 43: 109–114.[Medline]
  12. Bender A, Ernst N, Iglesias A, Dornmair K, Wekerle H, Hohlfeld R. T cell receptor repertoire in polymyositis: clonal expansion of autoaggressive CD8+ T cells. J Exp Med 1995; 181: 1863–1868.[Abstract/Free Full Text]
  13. O’Hanlon TP, Dalakas MC, Plotz PH, Miller FW. The alpha beta T-cell receptor repertoire in inclusion body myositis: diverse patterns of gene expression by muscle-infiltrating lymphocytes. J Autoimmun 1994; 7: 321–333.[Medline]
  14. O’Hanlon TP, Dalakas MC, Plotz PH, Miller FW. Predominant TCR-alpha beta variable and joining gene expression by muscle-infiltrating lymphocytes in the idiopathic inflammatory myopathies. J Immunol 1994; 152: 2569–2576.[Abstract]
  15. Lindberg C, Oldfors A, Tarkowski A. Restricted use of T cell receptor V genes in endomysial infiltrates of patients with inflammatory myopathies. Eur J Immunol 1994; 24: 2659–2663.[Medline]
  16. Mantegazza R, Andreetta F, Bernasconi P, et al. Analysis of T cell receptor repertoire of muscle-infiltrating T lymphocytes in polymyositis. J Clin Invest 1993; 91: 2880–2886.
  17. Boehncke WH, Kuenzlen C, Zollner TM, Mielke V, Sterry W. Predominant usage of distinct T-cell receptor V beta regions by epidermotropic T cells in psoriasis. Exp Dermatol 1994; 3: 161–163.[Medline]
  18. Murata H, Kita Y, Sakamoto A, et al. Limited TCR repertoire of infiltrating T cells in the kidneys of Sjögren’s syndrome patients with interstitial nephritis. J Immunol 1995; 155: 4084–4089.[Abstract]
  19. Wucherpfennig KW, Newcombe J, Li H, Keddy C, Cuzner ML, Hafler DA. T cell receptor V alpha-V beta repertoire and cytokine gene expression in active multiple sclerosis lesions. J Exp Med 1992; 175: 993–1002.[Abstract/Free Full Text]
  20. Bucht A, Oksenberg JR, Lindblad S, Gronberg A, Steinman L, Klareskog L. Characterization of T-cell receptor alpha beta repertoire in synovial tissue from different temporal phases of rheumatoid arthritis. Scand J Immunol 1992; 35: 159–165.[Medline]
  21. Cornblath DR, Asbury AK, Albers JW, et al. Research criteria for diagnosis of chronic inflammatory demyelinating polyneuropathy (CIDP). Report from an Ad Hoc Subcommittee of the American Academy of Neurology AIDS Task Force. Neurology 1991; 41: 617–618.[Free Full Text]
  22. Notermans NC, Wokke JH, Franssen H, et al. Chronic idiopathic polyneuropathy presenting in middle or old age: a clinical and electrophysiological study of 75 patients [see comments]. J Neurol Neurosurg Psychiatry 1993; 56: 1066–1071.[Abstract/Free Full Text]
  23. Notermans NC, Wokke JH, van der Graaf Y, Franssen H, van Dijk GW, Jennekens FG. Chronic idiopathic axonal polyneuropathy: a five year follow up. J Neurol Neurosurg Psychiatry 1994; 57: 1525–1527.[Abstract/Free Full Text]
  24. Davies L, Spies JM, Pollard JD, McLeod JG. Vasculitis confined to peripheral nerves. Brain 1996; 119: 1441–1448.[Abstract/Free Full Text]
  25. Griffin JW, George R, Ho T. Macrophage systems in peripheral nerves. A review. J Neuropathol Exp Neurol 1993; 52: 553–560.[Medline]
  26. Maniatis T, Fritsch EF, Sambrook J. Extraction, purification, and analysis of mRNA from eukaryotic cells. In: Maniatis T, Fritsch EF, Sambrook J, eds. Molecular cloning, a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1982: 187–209.
  27. Maniatis T, Fritsch EF, Sambrook J. Synthesis and cloning of cDNA. In: Maniatis T, Fritsch EF, Sambrook J, eds. Molecular cloning, a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1982: 211–246.
  28. Lozeron P, Chabas D, Duprey B, Lyon–Caen O, Liblau R. T cell receptor V beta 5 and V beta 17 clonal diversity in cerebrospinal fluid and peripheral blood lymphocytes of multiple sclerosis patients. Mult Scler 1998; 4: 154–161.[Abstract/Free Full Text]
  29. Hartung HP, Jung S, Stoll G, et al. Inflammatory mediators in demyelinating disorders of the CNS and PNS. J Neuroimmunol 1992; 40: 197–210.[Medline]
  30. Koski CL. Humoral mechanisms in immune neuropathies. Neurol Clin 1992; 10: 629–649.[Medline]
  31. Melendez–Vasquez C, Redford J, Choudhary PP, et al. Immunological investigation of chronic inflammatory demyelinating polyradiculoneuropathy. J Neuroimmunol 1997; 73: 124–134.[Medline]
  32. McCombe PA, Pollard JD, McLeod JG. Chronic inflammatory demyelinating polyradiculoneuropathy. A clinical and electrophysiological study of 92 cases. Brain 1987; 110: 1617–1630.[Abstract/Free Full Text]
  33. Hughes RA, Gray IA, Gregson NA, et al. Immune responses to myelin antigens in Guillain–Barré syndrome. J Neuroimmunol 1984; 6: 303–312.[Medline]
  34. Harvey GK, Gold R, Hartung HP, Toyka KV. Non-neural-specific T lymphocytes can orchestrate inflammatory peripheral neuropathy. Brain 1995; 118: 1263–1272.[Abstract/Free Full Text]
  35. Pollard JD, Westland KW, Harvey GK, et al. Activated T cells of nonneural specificity open the blood–nerve barrier to circulating antibody. Ann Neurol 1995; 37: 467–475.[Medline]
  36. Hawke SH, Davies L, Pamphlett R, Guo YP, Pollard JD, McLeod JG. Vasculitic neuropathy. A clinical and pathological study. Brain 1991; 114: 2175–2190.[Abstract/Free Full Text]
  37. Panegyres PK, Faull RJ, Russ GR, Appleton SL, Wangel AG, Blumbergs PC. Endothelial cell activation in vasculitis of peripheral nerve and skeletal muscle. J Neurol Neurosurg Psychiatry 1992; 55: 4–7.[Abstract/Free Full Text]
  38. Steinman L. A few autoreactive cells in an autoimmune infiltrate control a vast population of nonspecific cells: a tale of smart bombs and the infantry. Proc Natl Acad Sci USA 1996; 93: 2253–2256.[Abstract/Free Full Text]
  39. Boehncke WH, Dressel D, Manfras B, et al. T-cell-receptor repertoire in chronic plaque-stage psoriasis is restricted and lacks enrichment of superantigen-associated V beta regions. J Invest Dermatol 1995; 104: 725–728.[Medline]
Received March 30, 2000. Accepted in final form September 10, 2000.




This article has been cited by other articles:


Home page
BrainHome page
N. Schwab, C. G. Bien, A. Waschbisch, A. Becker, G. H. Vince, K. Dornmair, and H. Wiendl
CD8+ T-cell clones dominate brain infiltrates in Rasmussen encephalitis and persist in the periphery
Brain, May 1, 2009; 132(5): 1236 - 1246.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
H. Koller, B. C. Kieseier, S. Jander, and H.-P. Hartung
Chronic Inflammatory Demyelinating Polyneuropathy
N. Engl. J. Med., March 31, 2005; 352(13): 1343 - 1356.
[Full Text] [PDF]


Home page
NeurologyHome page
B. C. Kieseier, M. C. Dalakas, and H.-P. Hartung
Immune mechanisms in chronic inflammatory demyelinating neuropathy
Neurology, December 24, 2002; 59(90126): S7 - 12.
[Abstract] [Full Text]


Home page
NeurologyHome page
T.H. Brannagan III, A. Pradhan, T. Heiman-Patterson, A.C. Winkelman, M.J. Styler, D.L. Topolsky, P.A. Crilley, R.J. Schwartzman, I. Brodsky, and D.E. Gladstone
High-dose cyclophosphamide without stem-cell rescue for refractory CIDP
Neurology, June 25, 2002; 58(12): 1856 - 1858.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Suppl
Right arrow Data Suppl
Right arrow Correspondence:
Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when Correspondence are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bosboom, W.M.J.
Right arrow Articles by Logtenberg, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bosboom, W.M.J.
Right arrow Articles by Logtenberg, T.
Related Collections
Right arrow All Immunology
Right arrow Vasculitis
Right arrow All Neuromuscular Disease
Right arrow Peripheral neuropathy
Right arrow Chronic inflammatory demyelinating polyneuropathy


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS